Monday , August 21 2017
Home / Articles / Livestock Industry / Future of Genomics in Poultry Breeding

Future of Genomics in Poultry Breeding




  • The commercialisation of genomic selection in chicken breeding programmes is tantalisingly close, according to Dr John Ralph of Aviagen Turkeys, and the technology could be available in turkeys soon.

    At the start of his presentation to the Turkey Science and Production conference in the UK earlier this year, Dr Ralph explained that genomics, in the context of his presentation, concerns the information on a bird’s DNA make–up and how this can be used in the selective breeding programme to deliver improvements in performance.

    Breeding companies are principally interested in genetic variation as this is what they exploit to deliver improvements in performance. One of the main sources of natural genetic variation between individuals at the DNA level is single base-pair differences called Single Nucleotide Polymophisms (SNPs). These can be readily detected in the laboratory using blood samples and a process called genotyping.

    Example of single nucleotide polymorphism
    Bird 1 …GATGGCTCTTTGGAAGAAGATGACTATCATGCCACAACCGAG…
    Bird 2 …GATGGCTCTTTGGAAGAGGATGACTATCATGCCACAACCGAG…

    Poultry breeders are interested in how these SNPs are related to traits of economic interest and how they can be used to develop novel selection tools.

    The combination of genomics information with currently available pedigree and phenotypic information will further improve rates of progress in product performance, said Dr Ralph.

    He identified two main potential benefits of genomics to the poultry industry. Firstly, the accuracy of selection will be improved because phenotypic information, e.g. reproduction, growth, feed conversion etc., is impacted by environmental factors as well as genetics. Furthermore, selection can be made for traits recorded in one sex or those not measured in all selection candidates, such as disease resistance. The second main benefit is better management of genetic variation within and between lines.

    Development of Genomics in Commercial Chicken Breeding

    In 2004, the International Chicken Genome Sequencing Consortium published the DNA sequence (genome) and more importantly for breeders, said Dr Ralph, the International Chicken Polymorphism Map was released in the same year. This covered some 2.8 million SNPs and made the possibility of using DNA–based selection in poultry breeding programmes into a reality.

    Sparse coverage of the genome with markers required detailed studies to understand the linkage of potentially useful markers to traits of interest before 2004. No big players were found but rather a large number with small effects, said Dr Ralph. Furthermore, these studies were very costly and in fact, significant progress had been achieved in poultry breeding programmes with the old techniques.

    But with the publication of the 2.8 million SNPs in 2004, it became possible for chicken breeders to run genome–wide marker association studies. The result, he said, was a panel of SNPs that can be routinely used from selection purposes although he highlighted the problem that it has been challenging to identify robust SNPs that are validated across generations.

    An alternative approach to using markers in breeding programmes, genomic selection, was proposed in 2001 and involved typing birds using a large panel of densely spaced markers across the genome to predict the genetic merit of a particular individual. This is a costly procedure and in 2005, an industry-funded project – involving Aviagen, Iowa State University, the University of Wisconsin and the Roslin Institute – was set up to investigate the feasibility of genomic selection in a commercial breeding operation.

    According to Dr Ralph, the evaluation of genomic selection in this project is at an advanced stage.

    Application of Genomics in Turkey Breeding

    Advances in the development of genomic technologies have been rapid, he said, explaining that the turkey genome was published in 2010 at a fraction of the cost of the chicken genome just six years previously.

    It is clear that the background resources needed for chicken breeders to progress genomics is fast becoming a reality for turkey breeders, he added.

    The commercial application of genomic selection in chicken breeding programmes is tantalisingly close, according to Dr Ralph. Although the same challenges are presented in integrating genomics–based technologies into turkey breeding as with chickens, the time–scale for delivery in turkeys will be shorter because of the groundwork already done by the chicken breeders.

    Already, commercial breeders are able to capitalise on the progress made in chicken breeding operations and the wide experience of the project team members should avert any unexpected problems.

    It is anticipated that the application of genomics in turkey breeding will enhance improvements in low–heritability and difficult–to–measure traits such as disease resistance, immuno-competence, robustness and welfare–related traits, said Dr Ralph.

    Summing up the current position, he said, the prospects for genomics in turkey breeding is now a technical reality. Decisions about future progress will be based on validation in chickens, cost–benefit analysis and viewed in context of alternative breeding investments.

    Putting the scientific advances into perspective, Dr Ralph added: “At the end of the day, the success of a breeding operation will be judged by how the breed performs in the hands of the customer, not the sophistication of the breeding process.”

    About admin

    Check Also

    Attack on raw milk farmers continues in Pennsylvania:

    Report Issue: * Suggest Edit Copyright Infringment Claim Article Invalid Contents Broken Links Your Name: …

    Leave a Reply

    Be the First to Comment!

    Notify of
    avatar
    wpDiscuz